/ KUNCI GITAR CLOSEHEAD JANJI MANISMU Chord Gitar + Lirik Adalah Kekuatan Closehead Intro : D A D A D A E D A E Kemana ku kan pergi Jump to. Sections of this page. Accessibility Help. Press alt + / to open this menu. Facebook. Email or phone: KUNCI GITAR +62
Lirik Kunci gitar, Chords Gitar, Kord Gitar Closehead - Berdiri Teman : [Intro] Am G C F Am C C F C G Am G/B C Am F C G Kering kerontang jalan yang terbentang Am F C G Teka-teki hidup apalagi ini Am F C G F Hati pun melemah saat kan kembali pulang Am F C G
cash. Intro G C D C-C G C D.. G C D C-C G C D C.. G Am masa mula baru bercinta.. G Am mulut manis semacam gula.. D gunung tinggi sanggup didaki D G lautan api sanggup renangi.. Int. G C D C-C G C D C.. G C D C-C G C D C.. G Am tapi bila dah kenal lama.. G Am baru terlihat perangai sebenar.. D habis madu sepah dibuang.. D G janji manis tinggal kenangan.. Int. G C D C-C G C D C.. G C D C-C G C D C.. G.. Reff Em Am benar.. kata orang dahulu D G kasih jangan keterlaluan.. Em Am sayang.. biarlah sederhana D G takut nanti engkau merana.. Em Am benar.. kata orang dahulu D G kasih jangan keterlaluan.. Em Am sayang.. biarlah sederhana D G -D-G-Em9/G takut nanti engkau merana.. Musik Am.. G Am.. D..D..D.. G C D C-C G C D C.. G.. Reff Em Am benar.. kata orang dahulu D G kasih jangan keterlaluan.. Em Am sayang.. biarlah sederhana D G takut nanti engkau merana.. Em Am benar.. kata orang dahulu D G kasih jangan keterlaluan.. Em Am sayang.. biarlah sederhana D G C D takut nanti engkau merana.. C-C G C D engkau merana.. C.. G Janji manisnya.. Outro G C D C-C G C D C.. G.. Chord Kugiran Masdo - Janji Manis Lihat semua Chord Kugiran Masdo
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose CCCCDCAmCCCCCCCCCCECCCAmCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCECCCFCCCCCCCCCCCCCCCCGCDmCCCCCACCCCCCCCCFCCCCCCGCCCCCCCAmCCCCCCCEmCCCCCCCFCCCGCCCCCCCCCCCCCCDmCCCCCAmCCCCCCCCCFCCCCCCGCCCCCCCCCCCFCCCGCCCCCCCACCCCCCCCCCCCCCEmCGCCCCCCCDCCCCCCCCGCCCCCCCCCCCCCCCCCCCCCCCFCCCCGCCACCCCCCCCCCCCGCEmCCCCCCCCCCDmCCCCCDCCCCCCCCCCECCCCCCFCCCCGCCCAmCCCCCCCECCCCCCCAmCCCCCCCCCCCCCCCCCCCCCCCCCCECACCCFCCCGCCCCCCCCCCEmCCFCCCCCCCACCCCCCCCCCCCCCCGCCCCCCCBCCCFCCCCCCCGCCCCACCCCCCCECGmCCCCCGCCCCCCCFCCCCCCCCFCCCCCCCCCCCCCCCECCCCCCCCCCCCCCCCACCCCCCCCCCCCCCCDmCCCCCCCDCCCCCCDmCGCCCCCCCCCCCCCDmCFCCCCCCCCFCCCGCCCDCCCACCCCCECDCCCCDmCCCCCCCDCCCDmCDCCCCCCCDmCECCCCCCCCFCCCGCCACCCCCCCCFCCCGCCCFCCCCGCCCFCCCGCCCDCAmCCCCCECCCGCCCCACCCAmCCCCCECCCCCAmCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCFCAmCCCCCCCCCCECCCAmCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCECCCACCCCCCCECCCCCCCACCCCCCCCCCCCCCCCCCCCCCCCDCCCCACCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNCNNNDNAmNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNENNNFNNNNNCNNNNNNNNNNNDmNNNNNANNNNNNNNNFNNNNNGNNNNNNNAmNNNNNNNEmNNNNNNNFNNNGNNNCNNNNNNNNNFNNNNNAmNNNNNNNCNFNNNNNGNNNNNNNNNCNFNNNGNNNNNNNANNNNNAmNNANNCmNENGNNNCNNNDNNNNNNNGNNNNNNNNNNNNNNNCNNNNNNNFNNNGNNANNNNNNNNNNNNDNEmNNGNNCNNNDmNNNNNDNCNNNNNNNNENNNNNNFNNNGNNNAmNNNNNFNENNNCNNNAmNNNNNNNNNNNNNNNNNNNNNNNENNNANNNFNNNGNCNNNNNNENNGNNFNNNNANNNNNNNFNNNNNNNGNNNNNNNBNNNFNNCNNNNGNNNANNNNNNNENNNGNNNGNNNNNNNFNNNNNNNFNNNNNNNNNNNNNNNENNNNNNNNNNNNNNNANAmNNNANNNNNNNNNGNDmNNCmNNDNNNNNNNGNNNNNNNNNNNNNDmNNNCNNNNNNFNNGNNNDNNNANNNNNNNDNNNDmNNNNNCmNDNNNNNNNCNNNNNNNNENNNNNNNFNNGNNNANNNNNNNNFNNNNNNNNNNNGNNNFNNGNNNNNAmNNNNNNNENNNGNANNNAmNNNNNENNNNNNAmNNNNNNENNNNNCNNNAmNNNNNEmNNNCNNNAmNNNNNNNEmNENNNNNAmNNNNNNNNNNNNNNNNNNNNNNNNNNNENNNNANNNNNNNNENNNNNNANNNNNAmNNANNNNNNCNNNNAEmNNCNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
kunci gitar closehead janji manis